Behoedzaam voorwaarts met CRISPR-Cas

De evolutie in eigen hand

Nieuwe genetische technieken, zoals CRISPR-Cas, zouden ziektes kunnen uitbannen en voedselproblemen kunnen verhelpen. Maar regelgeving en standpunten dateren nog uit de vorige eeuw.

Medium hh 70069739
CRISPR-Cas9, Streptococcus pyogenes (pusvormende streptokokken). Proteïnen rood, DNA en RNA geel © Science Photo Library / HH

Even een citaat:crispr heeft een ongelooflijke potentie om de wereld te verbeteren. Stel je voor dat je genetisch de meest ernstige erfelijke ziektes kunt uitbannen, net als vaccinaties een eind maakten aan de pokken en straks ook aan polio. Stel je voor dat duizenden onderzoekers crispr gebruiken om de gesel van kanker te onderzoeken en tot nieuwe behandelingen of zelfs genezing komen. En stel je voor dat boeren, telers en kwekers de voedselcrisis oplossen door hun gewassen met crispr beter bestand te maken tegen het veranderende klimaat. Deze scenario’s kunnen binnen handbereik liggen, afhankelijk van de keuzes die we in de komende jaren maken.’

Aan het woord is Jennifer Doudna, microbiologe aan Berkeley University. Deze zomer bracht ze een bijzonder boek uit: A Crack in Creation: The New Power to Control Evolution. In de pers werd het boek vergeleken met de klassieker The Double Helix (1953) van James Watson. Dat is een kleurrijke beschrijving van de ontdekking van de wenteltrapstructuur van het dna, een vondst die hem in 1962 samen met Francis Crick en Maurice Wilkins de Nobelprijs opleverde. De vergelijking wordt niet zomaar gemaakt. In de wetenschappelijke wereld verwacht men dat Jennifer Doudna ook de Nobelprijs gaat ontvangen voor crispr, alleen is nog niet duidelijk wie er nog meer in gaan delen.

Een vooraanstaande onderzoekster dus die, samen met collega Sam Sternberg, voor een breed publiek een toegankelijk boek over haar onderzoek schrijft. Op zich is dat al bijzonder. Nog opmerkelijker is dat ze de tweede helft van het boek, The Task, inruimt voor een discussie over de toepassingen van The Tool, waar het eerste deel over gaat. De in Hawaï geboren microbiologe opent het boek zelfs met het schrikbeeld van een tsunami, symbool voor de stortvloed van toepassingen van de afgelopen paar jaren. ‘Had I created a monster?’ vraagt ze zich af.

Maar meer nog dan over misbruik van crispr maakt ze zich zorgen over de mogelijkheid dat crispr niet gebruikt gaat worden: ‘Zullen genetisch bijgewerkte gewassen hetzelfde lot ondergaan als gmo’s, een ander type genetisch gemodificeerd voedsel dat een ongelooflijke, en naar mijn mening slecht geïnformeerde, weerstand heeft opgeroepen ondanks de enorme mogelijkheden?’

Het boek is haar bijdrage aan een wereldwijde discussie over de genetische techniek waar wetenschappers op de International Summit on Human Genome Editing eind 2015 toe opriepen. Beter behoedzaam voorwaarts dan dat de techniek een slechte naam krijgt door roekeloze experimenten.

Een daarvan staat op naam van Josiah Zayner, een Amerikaanse biochemicus die afgelopen maand de pers haalde door crispr op zichzelf toe te passen. Onder het motto ‘mijn lichaam, mijn genen’ had hij zijn eigen dna aangepast door het gen voor myostatine weg te poetsen. Zonder myostatine groeien spieren verder door, zoals bij dikbilrunderen en Texelse schapen van nature het geval is. Biohacker Zayner injecteerde zichzelf met zijn bijgewerkte dna. Maar het enige wat erdoor groeide was zijn ego, niet zijn biceps. Zayner verkoopt nu setjes waarmee anderen ook hun genoom naar eigen inzicht kunnen bijpunten.

Op dit soort kermisattracties zitten serieuze onderzoekers niet te wachten, omdat ze vrezen dat het crispr een slechte naam bezorgt. Doudna nog even: ‘De mogelijkheden van crispr – goed en kwaad – zijn alleen beperkt door ons voorstellingsvermogen. Als soort hebben we nooit eerder deze mogelijkheden gehad. De macht over de genetische toekomst van onze eigen soort is zowel ontzagwekkend als vreesaanjagend. Beslissen over hoe hiermee om te gaan is misschien wel de grootste uitdaging die ons te wachten staat.’ Dat is andere koek dan de genetisch gemodificeerde soja en maïs, waar tot nu toe de discussie vaak over gaat.

Genetische modificatie, hebben we het daar al niet eerder over gehad? Jawel, zo’n veertig jaar geleden. In 1973 waren onderzoekers Herb Boyer en Stanley Cohen erin geslaagd om met recombinant-dna-technologie een stukje dna van het ene organisme in een ander organisme onder te brengen. De eerste transgene bacterie was een feit. In 1982 volgde de eerste transgene tabaksplant en rond dezelfde tijd volgden tal van genetisch bijgewerkte (laboratorium)muizen, ratten, schapen en ander vee. Over het algemeen gaf dat weinig ophef, met uitzondering van stier Herman, wiens dochters de stof lactoferrine in hun melk produceerden.

Zodra het iets eetbaars betreft, ontstaat er al gauw ongerustheid, althans in Europa. De angst voor Frankenstein-food, gen-gewassen en onnatuurlijk dna is hier stevig geworteld. Praktisch gezien heeft Europa de poorten gesloten voor genetisch gemodificeerde gewassen (gmo’s) en negeert het gemakshalve de genetisch gemodificeerde gisten en bacteriën uit de biotechnologische sector. Daarmee leek de kwestie afgedaan.

Maar nu keert het hele gen-debat als een boemerang terug. De technologie heeft zich stormachtig ontwikkeld, zeker sinds de opkomst van crispr in 2012, maar de standpunten zijn ongewijzigd. crispr heeft gentechnologie ongekend doelgericht, efficiënt en goedkoop gemaakt. Daardoor zijn zaken die altijd ergens ver in de toekomst leken te liggen opeens actueel geworden. Het uitbannen van bepaalde erfelijke ziektes of het uitroeien van muggen als overbrengers van malaria is niet denkbeeldig meer.

Annelien Bredenoord, hoogleraar ethiek van biomedische innovatie in Utrecht en senator voor d66, vindt dat de vooruitgang in genetische techniek ons dwingt om onze standpunten opnieuw te bezien. Zo hebben we altijd gedacht dat het onverantwoord was om veranderingen in de kiembaan aan te brengen omdat die overerven in de volgende generaties. Tot nu toe was dat de Rubicon van de genetische modificatie, een grens die we nooit zouden oversteken, maar zelfs die moeten we opnieuw bezien, vindt Bredenoord. Als voorbeeld van verantwoorde genetische innovatie in de kiembaan noemt ze de beslissing van het Britse parlement om in embryo’s de mitochondriën te mogen vervangen.

De bbc kopte begin 2015: ‘MPs Said Yes to Three-Person Babies’, wat sappig klinkt en in feite ook klopt. Van de derde persoon wordt een eicel zonder de kern gebruikt, maar met gezonde mitochondriën die essentieel zijn voor de energiehuishouding van de cel. Het kind, en zijn nageslacht, zijn eens en voor altijd van de mitochondriale aandoening verlost. Bredenoord beschouwt het breed gedragen en zorgvuldige proces dat aan de wetgeving vooraf ging als een goed voorbeeld van maatschappelijke besluitvorming. Ze zou graag zien dat over crispr op een soortgelijke open en niet-dogmatische manier gedacht en gepraat gaat worden.

‘De macht over de genetische toekomst van onze eigen soort is zowel ontzagwekkend als vreesaanjagend’

crispr-Cas, de techniek die nu ter discussie staat, heeft een onwaarschijnlijke oorsprong. De Wageningse microbioloog John van der Oost liep er begin 2000 voor het eerst tegenaan. Hij bestudeerde een microbe uit een vulkanische bron uit het Yellowstone Park in Noordwest-Amerika en las daarvan het dna uit. Van der Oost: ‘Daar kwamen we repeterende sequenties in tegen die tegenwoordig crispr’s genoemd worden. Dat was de eerste keer dat we die tegenkwamen. Als je zo’n sequentie uitschrijft en je print dat in regels uit, dan zie je al van veraf een patroon.’

Wat hij zag waren steeds dezelfde stukken van ongeveer dertig genetische letters A, T, C of G (repeats), met daartussenin andere sequenties met een andere volgorde (spacers). Pure geheimtaal. Elke letter staat voor één van de vier basen in het dna waarin de erfelijke informatie is vastgelegd. Het menselijk dna, of genoom, telt drie miljard baseparen die 21.000 genen bevatten. Een gen is een stuk dna dat het recept voor een eiwit beschrijft.

De repeats die Van der Oost zag hadden van links naar rechts dezelfde volgorde als andersom. Met andere woorden: het waren palindromen zoals woorden als ‘meetsysteem’ of ‘racecar’. De Nederlandse onderzoeker Ruud Jansen (destijds in Utrecht) bedacht in 2002 de naam Clustered Regularly Interspaced Short Palindromic Repeats, kortweg crispr. De term ‘clustered’ betekent dat de spacers en repeats opeengepakt bij elkaar zaten en niet verspreid over het dna. crispr leek een te regelmatig patroon om toevallig te zijn, maar daar bleef het ook bij. Van der Oost: ‘Het was wel een grappig verschijnsel, maar van de biologische relevantie hadden we geen idee.’

Totdat in 2005 de Russische bio-informaticus Eugene Koonin in Wageningen over de vloer kwam. Die wist te vertellen dat het dna in de tussenliggende spacers overeenkwam met bacteriële virussen. Dat was een ontdekking van de Spaanse onderzoeker Francisco Mojica.

Net als wij worden ook bacteriën onophoudelijk aangevallen door virussen. Virussen die bacteriën aanvallen heten bacteriofagen, of kortweg fagen – zij die bacteriën eten. Dat doen ze niet letterlijk, maar ze dringen wel bacteriën binnen, zetten de bacterie er vervolgens toe aan om veel kopieën van het virus te maken en maken de bacterie dan kapot, zodat de nieuwe kopieën zich vrij kunnen verspreiden om nieuwe slachtoffers te maken. De wereld is een wrede plek.

Dat er kopieën van viraal dna teruggevonden werden in bacteriën bracht Mojica op het idee dat het hele crispr-systeem met repeats en stukken viraal dna wel eens een bacterieel afweersysteem zou kunnen zijn. Alsof een bacterie een notitieboekje bijhoudt van de gevaarlijke virussen in zijn omgeving. Meestal zijn dat er enkele tientallen, maar soms ook honderden.

crispr als een bacterieel afweersysteem, Van der Oost vond dat zo’n fascinerend idee dat hij besloot de Vici-onderzoeksbeurs die hij net had gekregen daarvoor in te zetten. Hij vroeg zijn promovendus Stan Brouns om aan te blijven als postdoc. Samen met assistent in opleiding Matthijs Jore ging Brouns aan de slag om het idee te testen.

Twee jaar later hadden ze aangetoond dat ze de bescherming tegen virussen inderdaad konden beïnvloeden met virale sequenties in de spacers. Met de juiste sequentie was de bescherming miljoen keer beter dan zonder. Nog een jaar later konden ze ook laten zien hoe het systeem werkte. Want de crispr-volgorde in het dna is maar het halve verhaal. Daarnaast zit een handjevol genen die de instructies bevatten voor speciale eiwitten, CRISPR associated proteins, kortweg Cas. >

Het complete systeem heet dus crispr-Cas en de eiwitten zijn de uitvoerders. Eiwitten zijn moleculaire werktuigen. Door hun specifieke ruimtelijke vorm, en vaak in onderlinge samenhang, voegen ze andere moleculen samen, knippen ze door, laten ze passeren, of houden ze tegen.

Van der Oost en zijn groep beschreven een complex van eiwitten met de naam Cascade. Een model van het eiwitcomplex ligt op zijn werktafel, zo groot als een kinderhand. Pas als hij het witte knobbelige model openklapt zie je hoe het complex werkt. Het trekt de twee strengen van het dna uit elkaar en glijdt langs de hele keten op zoek naar een stuk dat letter voor letter overeenkomt met een opgeslagen kopie van het virus-dna.

Doudna beschrijft dat als volgt: ‘De moleculaire machine windt zich strak om het dna, als een python rond het lijf van een gazelle. Cascade werkt als gps-coördinaten die precies aangeven welk deel van het viraal dna vernietigd moet worden.’

Wat er vervolgens gebeurt wanneer er een match is, hangt van het Cas-eiwit af. Het meest rücksichtslos is Cas3, dat als een motorzaag tekeergaat. Doudna: ‘Cas3 begon langs het faaggenoom te bewegen met een snelheid van meer dan driehonderd baseparen per seconde, het dna versnipperend, een spoor van brokstukken van het viraal dna in zijn kielzog achterlatend.’

‘Ik denk dat er pas wat gaat veranderen in Europa als ze door hebben dat ze er heel veel geld mee gaan verliezen’

In 2011 ontdekten Jennifer Doudna, Emmanuelle Charpentier en tal van internationale onderzoekers in Berkeley de uiterst beheerste, en bruikbare, variant Cas9. Cas9 dat geladen is met een stuk rna als gids zoekt een corresponderende code in het dna, en knipt de streng daar doormidden. Doudna: ‘Hier hadden we een programmeerbaar werktuig dat we op iedere willekeurige dna-volgorde konden afsturen volgens de eenvoudige regels A past bij T, G past bij C enzovoort. Voor elke volgorde van twintig genetische letters die het gids-rna bevatte, zou Cas9 de passende tegenhanger in het dna vinden, en snijden. Dit was het perfecte bacteriële wapen: een virus-zoekende raket die snel en met ongelooflijke precisie kon toeslaan.’

En hoewel afkomstig uit bacteriën bleek het crispr-Cas9-systeem in iedere celsoort te werken die de onderzoekers uitprobeerden. Of het nu een microbe was of een cel uit een plant, dier of mens, crispr-Cas9 werkte overal.

Wanneer Cas9 een knip maakt, treedt het reparatiemechanisme van de cel in werking om de breuk zo snel mogelijk te herstellen. Meestal gaan daarbij één of enkele baseparen verloren en raakt het gen uitgeschakeld. Als onderzoekers ervoor zorgen dat er een ander gen in de buurt is, wordt dat er door de cel snel tussen geplakt. Doudna schrijft: ‘We begonnen ons te realiseren, tot onze eigen verwondering, dat we op een systeem gestuit waren dat omgevormd kon worden tot een veel gerichter en eenvoudiger systeem voor genetische bewerkingen dan tot nu toe bekend was.’

Genetische technieken waren altijd bewerkelijk, tijdrovend, duur, en ze hadden een lage kans op succes. Typisch minder dan één procent. Maar met crispr kan een onderzoeker achter zijn laptop in databases een twintigletterige volgorde als ACCTGGCCAGACCTCCGAGT opzoeken als doelsequentie en die online bestellen. Een gespecialiseerd laboratorium maakt de overeenkomstige rna-kopie voor een paar tientjes. Het rna wordt als gidsmolecuul toegevoegd aan het Cas9-eiwit. Eenmaal binnen in een cel gaat het eiwit op jacht naar de opgegeven plek en maakt een knip. Het succespercentage ligt tien tot honderd keer hoger dan bij voorgaande technieken.

Dat maakt ingrepen mogelijk waar tot nu toe alleen van gedroomd kon worden. Afgelopen augustus presenteerde het Amerikaanse bedrijf eGenesis van de onderzoekers George Church en Luhang Yang (Harvard University) 37 genetisch opgeschoonde biggetjes. Varkens hebben dezelfde orgaangrootte als mensen, dus ze worden wel eens overwogen als orgaandonoren (xenotransplantatie) voor lever, hart en nieren. Maar het feit dat hun dna vol met ingebouwde virussen zit is daarbij een risicofactor. Bij de biggetjes van eGenesis zijn die retrovirussen op 62 plekken in het varkensgenoom verwijderd. Daarmee is eGenesis halverwege. Nu moeten de varkens nog vermenselijkt worden, zodat ze het menselijk afweersysteem niet aanzetten tot afstoting. Ook daaraan wordt gewerkt.

Inmiddels hebben onderzoekers met crispr-Cas taaislijmziekte genezen in longcellen, bloedcellen met sikkelcelanemie gerepareerd en de ziekte van Duchenne verholpen in spiercellen. Let wel, in een bakje met cellen. Niet in het lichaam helaas, omdat niet iedere cel afzonderlijk te bereiken is. Maar als je de genetische correctie in een embryonale stamcel zou uitvoeren, is het denkbaar dat de correctie wél in iedere cel is doorgevoerd.

Van der Oost is daar optimistisch over: ‘Ik denk dat het steeds veiliger wordt en dat we binnen vijf of maximaal tien jaar dit zo veilig kunnen doen dat je het kunt toepassen. En dat het ook betaalbaar gaat worden, dus dat het niet alleen voor de rijke mensen is die dan hun genoom kunnen laten oppoetsen. Tenminste, ik hoop dat het zo werkt.’

Stan Brouns, die bij Van der Oost gepromoveerd is, is terughoudender: ‘Aan embryo’s sleutelen is voor mensen een heel grote stap. Los van de vraag hoe haalbaar dat nu is. Ik denk dat embryo-editing in Europa verboden gaat worden. Zeker voor verbeteringsdoeleinden zonder medische aanleiding.’

Terug naar vandaag. De genmachine crispr-Cas9 is het favoriete werktuig voor biotechnologen en genetici geworden en er gaat geen week voorbij zonder opmerkelijk nieuws op dit gebied. Daartegenover staat de Europese regelgeving, als een slagboom in een verlaten landschap.

John van der Oost vertelt dat Amerikaanse onderzoekers met crispr-Cas9 bij champignons een gen hebben uitgeschakeld dat bruine verkleuring geeft als je ze doorsnijdt. De wit blijvende champignons zijn in China volop verkrijgbaar, maar Europa houdt ze tegen omdat het als gmo beschouwd wordt, terwijl zo’n verandering (mutatie) ook spontaan kan ontstaan. Op dat niveau voltrekt zich nu de besluitvorming.

‘Dat is weer typisch Europa, om heel lang over die toelating te doen’, zegt Van der Oost. ‘Ik denk dat er pas wat gaat veranderen in Europa als ze door hebben dat ze er heel veel geld mee gaan verliezen. Want dat zit er natuurlijk aan te komen. crispr-Cas gaat in de hele biotechnologie een enorme impact hebben en als je vol op de rem gaat staan, is dat erg schadelijk. In de jaren negentig zijn veel plantenbiotechnologiebedrijven uit Nederland weggegaan omdat de regelgeving te beperkend was. Ze mochten niks meer. Dat is heel irritant geweest.’

De Koninklijke Nederlandse Akademie van Wetenschappen (knaw) deelt zijn standpunt in het Visiedocument Genome editing dat in 2016 uitkwam: ‘Wanneer de regelgeving in de EU en/of Nederland ontwikkelingen rond genome editing onvoldoende accommodeert, kan dit negatieve gevolgen hebben voor zowel het wetenschappelijk onderzoek in Nederland als voor commerciële toepassingen in bijvoorbeeld de land- en tuinbouw, een sector waar Nederland internationaal gezien een sterke positie heeft. Om te voorkomen dat verdere innovatie en de toepassing van genome-editingtechnieken onnodig worden gehinderd, is er behoefte aan verheldering en mogelijk aanpassing van de Europese regelgeving voor “genetisch-gemodificeerde” organismen.’

Een gevaar bij ethische discussies over gentechnieken is de breedte van het veld: van champignons tot Übermensch. Uit angst voor eugenetica, of uit protest tegen machtige multinationals, wijzen mensen technieken af die erg zegenrijk kunnen zijn.

Annelien Bredenoord, hoogleraar ethiek van biomedische innovatie in Utrecht, verlegt de discussie dan ook van de gentechnologie naar de waarden van de samenleving. ‘Verantwoordelijke innovatie begint met een inclusieve discussie met filosofen en ethici. Het publiek en de politiek moeten daarbij betrokken worden, omdat we moeten vaststellen wat onze waarden zijn, in termen van autonomie en kwaliteit van leven.’

De jonge microbioloog Brouns valt haar bij: ‘Het gaat niet om een ja of nee tegen deze technologie, maar meer over een “ja” in het ene geval en “nee” in een ander. Ik denk dat we dat onderscheid wel kunnen maken.’